The Naked Scientists

The Naked Scientists Forum

Author Topic: What would plant and tree DNA maps look like?  (Read 3408 times)

Don Pollack

  • Guest
What would plant and tree DNA maps look like?
« on: 29/10/2009 20:30:03 »
Don Pollack  asked the Naked Scientists:
   
Hello-

What would plant and tree dna maps look like? I was wondering what  alignment of the letter codes UCGA's, would describe, say an oak tree?

I am interested in how one would represent an oak in the dna code form.

thanks,
Don Pollack

What do you think?


 

Offline RD

  • Neilep Level Member
  • ******
  • Posts: 8132
  • Thanked: 53 times
    • View Profile
What would plant and tree DNA maps look like?
« Reply #1 on: 29/10/2009 21:08:19 »
All you need is an acorn and a few hundred bucks ...



 http://www.dna11.com/gallery_portraits.asp
« Last Edit: 29/10/2009 21:16:21 by RD »
 

Offline Don_1

  • Neilep Level Member
  • ******
  • Posts: 6890
  • Thanked: 7 times
  • A stupid comment for every occasion.
    • View Profile
    • Knight Light Haulage
What would plant and tree DNA maps look like?
« Reply #2 on: 30/10/2009 11:29:12 »
Perhaps not much unlike our own.

Humans share 35% of our DNA with:

Daffodils

I think perhaps some individuals my have slightly more DNA in common with daffodils than others!
 

Offline Nizzle

  • Hero Member
  • *****
  • Posts: 964
  • Thanked: 1 times
  • Extropian by choice!
    • View Profile
    • Carnivorous Plants
What would plant and tree DNA maps look like?
« Reply #3 on: 30/10/2009 12:15:58 »
It would just be a long series of letters.
Just like any living organism's dna would be represented.
 

Offline Bored chemist

  • Neilep Level Member
  • ******
  • Posts: 8668
  • Thanked: 42 times
    • View Profile
What would plant and tree DNA maps look like?
« Reply #4 on: 30/10/2009 19:45:28 »
Here's part of the sequence for arabidopsis thaliana
ATATCATTCATGGGCCCCTACGCATTACTCGGTACCAATCTCGCTCTCTCTCTCTAAGTCTTGAAACTCTATCAAGAATCTCAAGCCACCATTTTTTCTT
CATCTTCATAAAGAGAAAGAGAGAGATCCTCTTGTTTGGCAAGAACCCAATTTGAGTTCTAAGTCCTGATTTGCTTAGCTCTTTTCTTTCCTTGATTTCA
TTCTATATAAAGTCAACGGAAAGATATACATATATAGTTTTCTTCCGATTCTAGGGTTTTCATATTTCCTCTAAATTTTCATGGTCAAAGAAGAAAATCT
AAGAAACAATCGAACCAGCAAGAGAAAGAAGACTTCAATATCAACATCTCTCTCTCCCTCTCTCTCTCTTATATTATAAGATCTCGAGTTGAGTCATCAT
CATCGTCAATGGCTTTGAAAAACATCCGCAACAATTCACCAATTGAAGAACAAGAGAAAGGTTTAAACTTCATCAAGATTCACTAAGACCCACTAAGAGC
CAACTCAAAACTAAACGGAGCAAGGTTTTGCCAAAAACCAAAAAAAAAAAAAAAAAGATTCAAGAACCATCTCGTAAATCAAGATTTCTCCAAGGAAAAT
CAGATAAGTCATAATGGATCTATCCCTGGCTCCGACAACAACAACAAGTTCCGACCAAGAACAAGACAGAGACCAAGAATTAACCTCCAACATCGGAGCA
AGCAGCAGCTCCGGTCCCAGCGGAAACAACAACAACCTTCCGATGATGATGATTCCACCTCCGGAGAAAGAACACATGTTCGACAAAGTGGTAACACCAA
GCGACGTCGGAAAACTCAACAGACTCGTGATCCCTAAACAACACGCTGAGAGGTATTTCCCTCTAGACTCCTCAAACAACCAAAACGGCACGCTTTTGAA
CTTCCAAGACAGAAACGGCAAGATGTGGAGATTCCGTTACTCGTATTGGAACTCTAGCCAGAGCTACGTTATGACCAAAGGATGGAGCCGTTTCGTCAAA
GAGAAAAAGCTCGATGCAGGAGACATTGTCTCTTTCCAACGAGGCATCGGAGATGAGTCAGAAAGATCCAAACTTTACATAGATTGGAGGCATAGACCCG
ACATGAGCCTCGTTCAAGCACATCAGTTTGGTAATTTTGGTTTCAATTTCAATTTCCCGACCACTTCTCAATATTCCAACAGATTTCATCCATTGCCAGA
ATATAACTCCGTCCCGATTCACCGGGGCTTAAACATCGGAAATCACCAACGTTCCTATTATAACACCCAGCGTCAAGAGTTCGTAGGGTATGGTTATGGG
AATTTAGCTGGAAGGTGTTACTACACGGGATCACCGTTGGATCATAGGAACATTGTTGGATCAGAGCCGTTGGTTATAGACTCAGTCCCTGTGGTTCCCG
GGAGATTAACTCCGGTGATGTTACCGCCGCTTCCTCCGCCTCCTTCTACGGCGGGAAAGAGACTAAGGCTCTTTGGGGTGAATATGGAATGTGGCAATGA
CTATAATCAACAAGAAGAGTCATGGTTGGTGCCACGTGGCGAAATTGGTGCATCTTCTTCTTCTTCTTCAGCTCTACGACTAAATTTATCGACTGATCAT
GATGATGATAATGATGATGGTGATGATGGCGATGATGATCAATTTGCTAAGAAAGGGAAGTCTTCACTTTCTCTCAATTTCAATCCATGAGAAGTTTCAT
CATCTTCTTGTTTTGAATCTCTCTTTATATTGTTTCATTAGTAATTTTTCTAAGGGTATTAGATTCTAGCTAGTGAGAGGAAGAAAAAACGATCTTCTTC
GTTTTTTTGGTTATGATTTTTTTTTCCGACATGTTTCTTGATGTTCATCATCATTAGGCTTTTGTCACCATGTTGAAACTCGCATCTTTTCAATTTTGTA
TATAA


Fascinating isn't it.
I got it from here
http://www.arabidopsis.org/tools/bulk/sequences/index.jsp
and I have absolutely no idea what it means.
 

Offline Don_1

  • Neilep Level Member
  • ******
  • Posts: 6890
  • Thanked: 7 times
  • A stupid comment for every occasion.
    • View Profile
    • Knight Light Haulage
What would plant and tree DNA maps look like?
« Reply #5 on: 31/10/2009 14:18:39 »
Thank you very much BC!!!

I just tried to read that word. I shattered my teeth, twisted my tongue and have lockjaw.
 

Offline Bored chemist

  • Neilep Level Member
  • ******
  • Posts: 8668
  • Thanked: 42 times
    • View Profile
What would plant and tree DNA maps look like?
« Reply #6 on: 01/11/2009 14:10:46 »
Just as well I didn't copy the whole thing.
I think it was something like 500,000,000 base pairs long.
 

The Naked Scientists Forum

What would plant and tree DNA maps look like?
« Reply #6 on: 01/11/2009 14:10:46 »

 

SMF 2.0.10 | SMF © 2015, Simple Machines
SMFAds for Free Forums