The Naked Scientists

The Naked Scientists Forum

Author Topic: Forum Game- Post your Ctrl+V!!!  (Read 36556 times)

Offline Seany

  • Neilep Level Member
  • ******
  • Posts: 4209
  • Live your life to the full!
    • View Profile
Forum Game- Post your Ctrl+V!!!
« Reply #150 on: 02/04/2008 22:57:39 »

Never seen anything like that before, a mouse in a rotating condom.

How does it look like a rotating condom!!
 

Offline Seany

  • Neilep Level Member
  • ******
  • Posts: 4209
  • Live your life to the full!
    • View Profile
Forum Game- Post your Ctrl+V!!!
« Reply #151 on: 02/04/2008 22:58:11 »
http://www.autotrader.co.uk/EDITORIAL/editorial_images/non_imported/wotsit.jpg


Hmm.. That appears to be my Ctrl+V on a wotsit picture.. ;D
 

Offline Simulated

  • Neilep Level Member
  • ******
  • Posts: 7188
  • Thanked: 1 times
  • Simulated..What more do you needa know :P
    • View Profile
    • Facebook
Forum Game- Post your Ctrl+V!!!
« Reply #152 on: 03/04/2008 00:41:44 »
its some number, look important i don't thikn i should post it ha
 

Offline rosalind dna

  • Neilep Level Member
  • ******
  • Posts: 2019
    • View Profile
Forum Game- Post your Ctrl+V!!!
« Reply #153 on: 03/04/2008 00:54:16 »
 

Offline Seany

  • Neilep Level Member
  • ******
  • Posts: 4209
  • Live your life to the full!
    • View Profile
 

Offline Seany

  • Neilep Level Member
  • ******
  • Posts: 4209
  • Live your life to the full!
    • View Profile
Forum Game- Post your Ctrl+V!!!
« Reply #155 on: 03/04/2008 21:22:15 »
Weight lifting does NOT stunt growth. A friend of mine has been lifting since he was nine and he's fifteen and just as tall as me about 5'9. I'm sure you've all heard this before, but really dont push yourself. You can use a light to heavy weight as long as you have good form and are careful in not hurting yourself you should be fine. Steroids, however creates a myriad of problems and not only will it severly stunt your vertical growth it will make your bones brittle and weak.



That seems to be my CTRL+V!!

Hmm.. I still don't get how it looks close to a rotating condom..
 

Offline MayoFlyFarmer

  • Hero Member
  • *****
  • Posts: 863
    • View Profile
    • http://www.myspace.com/wiguyinmn
Forum Game- Post your Ctrl+V!!!
« Reply #156 on: 04/04/2008 18:30:59 »
just found this thread for the first time.  Kind of a neat idea.  I wasn't really going to post anything, but i was curious to see what mine was.  When i looked, it was so fitting to the forum i felt like i had to:

GTGGTTCAAAAGCTAGGCGGAAGGCGGGCAGGGAAAGGTCAAAGGTAAGTCTGGGCACCACTGGTCCTCG
GGCCTGAGCACTGTCCAGCCGCGACTGCCTTGGCGGCCACTTCCCTTCTTCCCCTTCTGTAGGCGGGACC
CTTTGGCAACTGCTTTTTCCCACTAGTTGATGAAAACGTCAATTTCATTTGCTGGCCAATTGACAGCCTG
TACTATTGGCTCCCAGCCTTAGGCTCCACCTTCCCGAGGCCCTGTATCCGGAAACAAACCAACGACAAGC
CAGGCACCTGGGGGGCGGAGGTGGGGGTTGTGATTCAAACTTCCGAGGCTCAAGACGGAGGTAATGCGCC
TGCGCCGCAAGGAGCACTATGGGAAGCAAAGACTCAGACATCCCAAGGCTTTTCGGGATTTGTAGTGTTA
TATTTTAGTATTGCCACTAAACCTATTTCCAGCTCCTAAGTAACTATCATAGTCACTGACATCCTTCACA
GGAAGATCATTCTGGAGACGGACTGGATCCTTTCTGACAGAGAGCTCGCTAGGTGTATTTCTCAGCTAAC
TCTCTTTCATTTAAATACTAAAAGCGCTGGGTACTCATCCACATAGTGAGGACGCTTTAACGAGCAAAAC
AGGCAAAAATCCTTGCTGAGAATGTGTCTTATCGTGTAGAGGATAGACGATAGTCAATAAACAAGCCAAA
AATTCTAAGTGAAATGTAATGGGAACACACAAATATGTAAAAATACTCAATAGGGAACATCAAAGTGGGG
ACTGAGACTTTATCATTATTTATTTATTGCCTCACTCTGGCTCAGTCTAGCCTGAAGCTCATTATGTATG
TGACCCAAGCTGTCTCTGAACTCCCGGAAGGCCTCCTGCCTCAGCCTCCCCAGTGTGTGATTAACACAAC
AACCTGTTGGGTATATGCTTTTCTTAACTTATTGGGGGGTGGGGCACACCTGTAGCAGTCAGATCACTTA
CAGGATTTGAGGATCAAACGCAGGTCATGACTGGCAGCAAGTGTCCCTACCATTGAGTTATCTCACTAGA
CTCTTTGCTGAAATTATGTTGACACAGGGTATCACTACAAACCCCAGCTGGCCTGGAAGTCACAGAAATC
CACCATGCCTCTGCTTCCCAAGTGCTGTGGTTTCAGACATAAGCCACCAAAATCATGAAATATTTATTTA
TTTATTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGG
CCTCGAACTCAGAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATAAAAGACGTGCACCACCACTGAC
TGGCCATGAAATTTTAAATGAGAAGATCAAGATGCCAGAGAAAGGGCTTGCTCACTTGTTGAGCGCAGTA
GTTAAGGGGATTCACATGGTGTCTAACAACCATGTATAATTGCAGTTCTAGAGGATGCTGATGTCCTCTT
CTGGTTCCCATGGGCACTACATAAAAGTACACACACACACACACACAAAACTAAATCAAGAATAAAGAAT
AGGCTGGGTGGTGGCGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGT
TCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGATGGCGAGGGCTACACAGAGAAACCCTGTCTCGAA
AAACCAAAAAAAAAAAAAAAAAAACAAACAAAACAACAACAACAAGAATAAAGAATAGGAAAGTCAAGGA
AGCTGTCCTAAGGAAGCTCCTGGATAAGACACCTCCCTTAGAGGGAGAAATGTGAATTCTTCCTTGGCAG
AGACTACCAAAGCCTAGAACAAGAAAGTGATTTTCTTGCTTGGTTTGTCAGGCTAGGAATGTTAACAGAG
TGCACTGCCAGTAAACTACTGCTCCAGTTCAGAAAGTTGTGTTTTTAAATCCACAACTACCCGGCTGGAG
AGGTGGCTCAGCGGGTAAGAGCACTGACTGCTCTTCTACGGGTCCTGAGTTCAAATCCCAGCCACCACAT
GGTGGCTGACACCCAGATGCCCTCTTCTGGAGTCTCTGAAGAGAGCACTGGTGTCCTCATATACATAAAG
TAAATAAATCTTAAATTCACAACTACTAGTGCAAGATAGGGGCCCCTCAAAGTGGGAGCGTCATTTCTTT
CCGAAGTAGGAAAGTTCTTATTTCAGAAAGGTACGAACAGTAGTTAATAAATAAAAATTCATACACTGGG
TAAAAGCACAAAGCCTAACATGTAACACATTCAGTAAGTGCCTTTGAGTGTTAGCAATCATTTTATCCTT
CTGGCTCCGAAAGATCCCAAGAACTCAATATTTAAAGTTAGGGTCCTTTATTGGGGCAGATGGGAAATGA
GAAACAGATGTCTTCAGGGTCTGAGGGAAAGCCTAGAGCAGAGAAGCCTTCATCCTGGGAGAAAGAACAG
ATCAGCAGCTTATGAAGTTGTTAGGGAGTGCCCAGGGGAATGGTGAAGGAGAGGTAGTCCCCAAGAGCGC

if anyone can figure out what that is, they get a cookie.


***well, it wouldn't let me post the whole thing because it was too long, so i deleted about 90% of it, but you get the point.  (I'm a big nerd)  If anyone can figure out what it is from just this much, you get 2 cookies   :o
 

Offline Seany

  • Neilep Level Member
  • ******
  • Posts: 4209
  • Live your life to the full!
    • View Profile
Forum Game- Post your Ctrl+V!!!
« Reply #157 on: 05/04/2008 00:11:24 »
LOL... now that is very interesting!!


Each sample is stored in its own specially marked storage unit. Some cryobanks split the specimens, storing half of any individual's specimens in two separate nitrogen tanks in case of tank malfunction. Some may actually store the two tanks on separate physical sites in case of an unforeseeable disaster to the building in which a tank is stored. The nitrogen tanks are checked daily for temperature and liquid nitrogen leakage.


Now that is my CTRL+v lol
 

The Naked Scientists Forum

Forum Game- Post your Ctrl+V!!!
« Reply #157 on: 05/04/2008 00:11:24 »

 

SMF 2.0.10 | SMF © 2015, Simple Machines
SMFAds for Free Forums